CHIL.ME

Elements with tag identificación

Nov 29, 2017 at 16:16

CITOLIVA y la AEI del sector oleícola INOLEO, presentan mañana, 29 de noviembre, los resultados finales del proyecto “ENTOMATIC”, liderado por la Universitat Pompeu Fabra (UPF) y financiado por el VII Programa Marco, que tendrá lugar en la sede del C.R.D.O. Sierra Mágina (Bedmar, Jaén), en cuya comarca la plaga de la mosca del olivo es endémica.

Aug 31, 2017 at 13:33

Los canales iónicos desempeñan un papel fundamental en el mantenimiento de la homeostasis celular, uno de los procesos más importantes en la producción vegetal. Los canales de potasio son sumamente interesantes porque transportan los nutrientes que utilizan las células en los procesos fisiológicos. El propósito de este trabajo fue detectar los códigos genéticos para el canal iónico del potasio AKT1 en las raíces de plántulas de pimiento bell. El PCR se estandarizó para la detección de AKT1 y se sintetizó el oligo: AAGATCAGATGCACCTTGACTT (se obtuvo la mejor alineación a una temperatura de 62 °C), para después ser secuenciado y analizado, dando como resultado una identidad del 94-97% en NCBI, con el gen AKT1.

Mar 26, 2013 at 00:00

Un trabajo desarrollado con la colaboración de la Universidad del País Vasco (UPV/EHU) ha identificado más de 400 genes implicados en la respuesta inmune de las plantas, a través de una novedosa estrategia que permite asignar rápidamente funciones a los genes secuenciados.

Dec 12, 2011 at 00:00

Atendiendo a la petición de varios países La Comisión Europea ha aplazado hasta finales de 2014 el periodo para completar el sistema de identificación.

Loading, please wait...